CRISPR-Cas off-target detection using Oxford Nanopore sequencing - is the mitochondrial genome more vulnerable to off-targets?
Chakraborty, S.
Show abstract
Oxford Nanopore sequencing of DNA molecules is fast gaining popularity for generating longer reads, albeit with higher error rates, in much lesser time, and without the error introduced by PCR-amplification. Recently, CRISPR-Cas9 has been used to enrich genomic regions (nCATS [1]). This was applied on 10 genomic loci (median length=18kb). Here, using the sequencing data (Accid:PRJNA531320), it is shown that the same flow can be used to identify CRISPR-Cas9 off-target edits (OTE). OTEs are an important, but unfortunately underestimated, aspect of CRISPR-Cas gene-editing. An OTE in the mitochondrial genome is shown having 7 mismatches with one of the 10 gRNAs used (GPX1), having as much enrichment as the targeted genomic loci in some samples. Previous study has shown that Cas9 bind to off-targets having as many as 10 mismatches in the PAM-distal region. This OTE has not been reported in the original study (still a pre-print), which states that sequences from parts other than the target locations arise from ligation of nanopore adaptors to random breakage points, with no clear evidence of off-target cleavage by Cas9 [1], Furthermore, a lot of reads aligning to the mitochondrial genome (sometimes full length) are inverted after the edit. It remains to be seen if these are bona fide translocations after the Cas9 edit, or ONP sequencing artifacts. This also raises the question whether the mitochondrial genome is more prone to off-targets by virtue of being non-nuclear. Another locus in ChrX (13121412) has only 1 mismatch with the second BRAF gRNA (GACCAAGGATTTCGTGGTGA). Although the number of reads for this OTE is less, its very unlikely this is random since it happens 8 out of 11 samples. With the increasing use of (TALEN/ZFN/CRISPR-Cas9) on human subjects, this provides a fast method to quickly query gRNAs for off-targets in cells obtained from the patient, which will have their own unique off-targets due to single nucleotide polymorphism or other variants.
Matching journals
The top 8 journals account for 50% of the predicted probability mass.
Similar papers in this journal
- Structural variability, expression profile and pharmacogenetics properties of TMPRSS2 gene as a potential target for COVID-19 therapy 94%
- DLO Hi-C Tool for Digestion-Ligation-Only Hi-C Chromosome Conformation Capture Data Analysis 93%
- Optical genome mapping as a next-generation cytogenomic tool for detection of structural and copy number variations for prenatal genomic analyses 92%
Similar papers in this journal
Similar papers in this journal
"Similar papers" are the closest papers from that journal in the model's embedding space. They show what the match is built on, but the ranking comes mostly from a classifier over the whole training set, not from these examples alone.