Association of MIOX with Autosomal Dominant Polycystic Kidney Disease

Autosomal Dominant Polycystic Kidney Disease is characterized by renal cyst development, often leading to kidney enlargement and failure. We conducted whole exome sequencing on 14 participants (12 families) from an Indian cohort. Our analysis revealed a spectrum of genetic variants, predominantly in the PKD1. These in PKD1 included missense variants such as p.Glu2937Lys (c.8809G>A) and p.Gly2310Arg (c.6928G>A), p.Asp2095Gly (c.6284A>G), p.Thr938Met (c.2813C>T), p.Trp967Arg (c.2899T>C), p.Glu593* (c.1777G>T), frameshift variants p.Gln149fs*141 (c.445delC), p.Ser3305fs*84 (c.9914_9915delCT), p.His1347fs*83 (c.4041_4042delCA), and p.Leu2776fs*87(c.8327_8363delTGGCGGGCGAGGAGATCGTGGCCCAGGGCAAGCGCTC), intronic splice site variant c.8017-3C>G, nonsense variant p.Glu593* (c.1777G>T) and in PKD2 missense variant p.Ser370Asn (c.1109G>A). While one individual carried intronic (c.2358+5G>A) and 3UTR (c.*174G>T) variants in PKD2 only another individual carried variants in both PKD1 and PKD2, suggesting potential genetic complexity. Clinical data revealed diverse presentations. Age at diagnosis varied widely. Patients with frameshift variants exhibited earlier onset and severe manifestations, including bilateral ADPKD. One proband had right unilateral ADPKD. Involvement of liver, a common extra-renal manifestation, was also observed. Heterogeneity at phenotypic and at allelic level was observed in our cohort. In this study, using WES of a trio, a frameshift-truncation deletion [c.32del/p.Leu11ArgfsTer61] in MIOX was found to be associated with the disease shared by both the affected and early diagnosed mother and daughter carrying PKD1 missense variant, which had not been previously reported in ADPKD. Further, differential gene expression analysis using data from GEO database showed reduced MIOX expression in ADPKD cystic samples compared to minimal cystic tissues and controls. MIOX is an enzyme specific to renal tubules and catalyses the initial step of the kidney-based myoinositol catabolism. Both affected candidates also shared benign variants and other variations of uncertain significance which may influence the disease development. Further functional analysis will clarify how MIOX contributes to the disease. The study limitations include the small sample size and the need for validation in larger cohorts. Our findings highlight the importance of genetic analysis in ADPKD management especially to facilitate personalized therapeutic strategies. HighlightsO_LIIdentified variants in PKD1 and PKD2 through whole exome sequencing in ADPKD patients, affecting different protein regions. C_LIO_LIVariants include non-synonymous coding changes, frame-shift deletions, and splice site alterations. C_LIO_LIClinical features and age at diagnosis varied widely, with common symptoms including flank pain, fatigue. C_LIO_LIFrameshift deletion in MIOX, associated in one PKD1 trio, implicates its role in ADPKD pathogenesis. C_LIO_LIDGE analysis of dataset from database reveals downregulation of MIOX in ADPKD tissue samples highlighting its role in potential molecular pathways in ADPKD progression. C_LI Graphical abstract O_FIG O_LINKSMALLFIG WIDTH=200 HEIGHT=117 SRC="FIGDIR/small/23288719v2_ufig1.gif" ALT="Figure 1"> View larger version (54K): org.highwire.dtl.DTLVardef@8b0229org.highwire.dtl.DTLVardef@3af2d9org.highwire.dtl.DTLVardef@1db8feorg.highwire.dtl.DTLVardef@15c4045_HPS_FORMAT_FIGEXP M_FIG C_FIG